SubtiBank SubtiBank
Version comparison:

2017-05-24 13:18:532025-05-25 09:47:32

locus

BSU09420

BSU_09420

proteinLength

343

334

geneLength

1029

1005

outlinks

bsu

BSU09420

BSU_09420

Gene

Coordinates

1,018,998 → 1,020,002

1,018,998 1,020,002

Gene

Phenotypes of a mutant

a ''[[gene|cwlO]] [[gene|lytE]]'' mutant is not viable [Pubmed|17581128,22139507]

growth defect at high temperature [Pubmed|21541672]

inactivation of ''[[gene|lytE]]'' strongly restores beta-lactam resistance in a ''[[gene|sigM]]'' mutant by delaying cell lysis [Pubmed|22211522]

a ''[[gene|lytE]]'' mutation is synthetically lethal with ''[[gene|ftsE]]'' and ''[[gene|ftsX]]'' mutation (due to a lack of autolysin activity) [Pubmed|23869552,23855774]

a ''[[gene|lytE]]'' mutation increases the cell separation defect of a ''[[gene|lytF]]'' mutant [Pubmed|23855774]

cells are thinner (reduced diameter) as compared to the wild type [Pubmed|23869552]

a ''[[gene|cwlO]] [[gene|lytE]]'' mutant is not viable [Pubmed|17581128,22139507]

a [[gene|ugtP]] [[gene|lytE]] double mutant has a severe [SW|cell shape] defect, thi can be suppressed by mutations resulting in reduced expression or activity of [[protein|PonA|PbpA]] [pubmed|33087775]

growth defect at high temperature [Pubmed|21541672]

inactivation of ''[[gene|lytE]]'' strongly restores beta-lactam resistance in a ''[[gene|sigM]]'' mutant by delaying cell lysis [Pubmed|22211522]

synthetically lethal with ''[[gene|ftsE]]'' and ''[[gene|ftsX]]'' mutation (due to a lack of autolysin activity) [Pubmed|23869552,23855774]

synthetically lethal with [[gene|sweC]] and [[gene|sweD]], this can be suppressed by point mutations in [[gene|ftsE]] or [[gene|ftsX]] [pubmed|31437162]

a ''[[gene|lytE]]'' mutation increases the cell separation defect of a ''[[gene|lytF]]'' mutant [Pubmed|23855774]

cells are thinner (reduced diameter) as compared to the wild type [Pubmed|23869552]

reduced colony size with accumulation of dead cells in the colonies [pubmed|29114240]

The protein

Catalyzed reaction/ biological activity

cleaves the peptide bond between D-Glu (position 2 in the peptioglycan peptide) and m-diamino pimelic acid (position 3) [Pubmed|18266855]

cleaves the peptide bond between D-Glu (position 2 in the peptioglycan peptide) and m-diamino pimelic acid (position 3) [Pubmed|18266855]

degradation of gamma-polyglutamic acid [pubmed|29458655]

The protein

Protein family

nlpC/p60 family (according to Swiss-Prot)

[SW|Peptidase C40 family] (according to UniProt)

The protein

Paralogous protein(s)

the C-terminal D,L-endopeptidase domains of [[protein|LytE]], [[protein|LytF]], [[protein|CwlS]], and [[protein|CwlO]] exhibit strong sequence similarity

[[this]]

The protein

[SW|Domains]

contains three N-acetylglucosamine-polymer-binding [SW|LysM domain]s [Pubmed|18430080]

C-terminal D,L-endopeptidase domain [Pubmed|22139507]

contains three N-acetylglucosamine-polymer-binding [SW|LysM domain]s [Pubmed|18430080]

C-terminal D,L-endopeptidase domain ([SW|NlpC/P60 domain]) [pubmed|29458655,22139507]

3 [SW|LysM domain]s (aa 26-69, aa 86-129, aa 149-192) (according to UniProt)

The protein

Effectors of protein activity

activity requires functional [[protein|MreB]] and [[protein|MreBH]] [Pubmed|23869552,16950129]

activity requires functional [[protein|MreB]] and [[protein|MreBH]] [Pubmed|23869552,16950129]

both enzymatic activities are inhibited by interaction with [[protein|IseA]] [pubmed|29458655]

Biological materials

Mutant

1A790 ( ''lytE''::''cat''), [Pubmed|9457885], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A790&Search=1A790 BGSC]

1A792 ( ''lytE''::''cat''), [Pubmed|1588906], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A792&Search=1A792 BGSC]

1A1024 ( ''lytE''::''spec''), [Pubmed|20400548], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1024&Search=1A1024 BGSC]

BKE09420 (''[[gene|lytE]]''::''erm'', available in the BGSC and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]

1A790 ( ''lytE''::''cat''), [Pubmed|9457885], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A790&Search=1A790 BGSC]

1A792 ( ''lytE''::''cat''), [Pubmed|1588906], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A792&Search=1A792 BGSC]

1A1024 ( ''lytE''::''spec''), [Pubmed|20400548], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1024&Search=1A1024 BGSC]

BKE09420 ([[gene|lytE]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09420 BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCTCCCCAAATG, downstream forward: _UP4_TAATTTTTAGAGAAAACCCG

BKK09420 ([[gene|lytE]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCTCCCCAAATG, downstream forward: _UP4_TAATTTTTAGAGAAAACCCG

References

Original publications

21261835, 22211522, 16950129, 17581128, 14594841, 9457885, 9573210, 10322020, 24125693, 23199363, 20059685, 14651647, 23869552, 21541672, 22139507, 23855774, 27118079

21261835, 22211522, 16950129, 17581128, 14594841, 9457885, 9573210, 10322020, 24125693, 23199363, 20059685, 14651647, 23869552, 21541672, 22139507, 23855774, 27118079, 25760608, 29114240, 29458655, 29914988, 29458657, 29465029, 31437162, 31808740, 33087775

The protein

Structure

[PDB|4XCM] (from Thermus thermophilus, 34% identity) [pubmed|25760608]